Imran Ali

Oooh Look! Pretty Computer!

Nicolas Negroponte's One Laptop Per Child project draws as much criticism as it does admiration.

Much of it is valid, such as Lee Felsenstein's studied critiques of OLPC's pedagogical philosophy; but sniping at the $120 hundred dollar laptop and its lo-fi technology based is missing the point. OLPC is an educational initiative not a laptop project. Guys like Lee are the ones who should be heard; his first-hand experience in bringing computing to third world communities is invaluable and insightful.

Educational and altruistic merits aside - OLPC's XO laptop is ostensibly an impressive piece of industrial design, conceived by Yves Béhar. However, perhaps more striking is Sugar, the XO's operating system, a variant of Fedora Linux. Sugar seeks to move away from traditional interface metaphors and explore more naturalistic concepts...

• Activities rather than applications.
• Groups and Neighborhoods to express other users in physical and logical proximity.
• A View Source key to encourage users to tinker.
• Replacing files and folders with a 'journal' oriented around recency and temporal granularity.
• Tagging, clipping, sharing and searching as system-wide features.

In reorienting the user experience around learning, children, openness and collaboration, Sugar promises to be the singular technological innovation of the XO...though it remains to be seen if Sugar or traditional UIs are better suited for learning.

With XOs restricted to the XO Giving programme in North American and to OLPC client nations, the only way to experience Sugar directly is through virtualisation and emulation. Along with, Windows Vista and OS X, my MacBook Pro is now also host to a Sugar installation running on Parallels...here's how it's done.

Though I've bene unable to access the web under emulation, playing with the journaling feature has been illuminating and points the way to new design patterns for web and desktop applications...Ian and I might pinch some of these patterns for Ensembli :)

In the meantime, it's worth checking out Sugar's Human Interface Guidelines and the guide to emulation.

{ taatacgactcactatagggaga }

I've been fascinated by Synthetic Biology since I had my mind blown by Drew Endy's talk on Remixing DNA at ETech 2005.

My friend's impending recruitment to the OpenWetWare Lab, Google's investment in 23andMe along with this week's Boing Boing and O'Reilly Radar coverage of Rudy Rucker's Our Synthetic Futures are all telling me I should be paying more attention to this subject...

Augmented Reality

Augmented Reality, Mixed Reality or AR, applications are nothing new, institutions such as MIT Media Lab have been developing various innovations in this field for many years. However, Total Immersion's D'fusion technology is one fo the first examples of productised AR technology; incidentally now being employed by companies such as BMW.

Total Immersion was one of last year's DEMOgods at the annual DEMO event in Scottsdale, Arizona. Their five-minute demo was a stunning example of AR principles and a playful showcase of their technology.

• See a Windows Media clip of the DEMOgod demo here...
• Download the D'fusion AR whitepaper here...

Doors Of Perception

"When people talk about innovation in this decade, they really mean design" - Bruce Nussbaum.

Doors Of Perception has been variously referred to as the "World Economic Forum for the design industry" and an "international focal point for design, industry and culture".

Doors is in essence a global design and innovation network that seeks to identify, discuss and develop next-generation design concepts - for information and communication technologies.

The theme for this year's event, Doors8Delhi, is INFRA - the infrastructure of social innovation. If I'm very lucky, my credit card bears up and I can endure the 32-hour flight from San Francisco to Delhi, I'm hoping to be able to report back on Doors8.

In the meantime, the TR team, colleagues from France Telecom R&D and Orange R&I will be attending the O'Reilly Emerging Technologies Conference in mid-March. ETech is an inspirational peek at the technologies, trends, people and companies that could mainstream in the next few years.

Resonantware

NEC Resonantware site is a great example of where design-led innovation is directing future development of NEC technologies. The site showcases a handful of conceptual product designs, including:

• Tag - a soft-shell mobile phone
• Flacon - a physical container for digital images
• Wacca - a bracelet whose surface carries an animated photo album

Though each product is conceptual and dependent on materials and technologies that do not yet exist, it allows NEC to imagine and therefore direct its future business with some foresight.